Trang chủ   Tin tức   Cơ sở dữ liệu    Đăng ký   Giới thiệu   Tìm kiếm: 
Infinite Menus, Copyright 2006, OpenCube Inc. All Rights Reserved.

Tương thích với

TIN TỨC > PHÂN LOẠI THỰC VẬT

Phân tích mối quan hệ di truyền tập đoàn giống cây Bách xanh (Calocedrus macrolepis) bằng chỉ thị RAPD và DNA lục lạp

Cập nhật ngày 20/11/2010 lúc 1:43:00 AM. Số lượt đọc: 3769.

Bách xanh (Calocedrus macrolepis) là loài cây thân gỗ, thân thẳng, phân cành sớm và phân tán rộng. Bách xanh phân bố ở vùng núi đá vôi phía Bắc và vùng núi đất phía Nam, trong các cánh rừng nguyên sinh rậm thường xanh hỗn giao nhiệt đới gió mùa núi thấp và ở độ cao 800 đến 1500m trên mặt biển.

Bách xanh là loài cây có khả năng cho nhựa giống như các loài cây cho tinh dầu khác, do vỏ có nhiều ống dẫn nhựa lớn, nhựa có mùi tinh dầu xá xị rất thơm, gỗ màu vàng nhạt, vân có màu vàng nâu, gỗ rất cứng và chứa nhiều tinh dầu có giá trị cao trong ngành công nghiệp mỹ phẩm và gia dụng. Cũng giống như hầu hết các loài cây rừng khác, việc đánh giá đa dạng di truyền quần thể mới chỉ tập trung vào một số đặc điểm hình thái. Để xây dựng dữ liệu về đa dạng dạng di truyền ở mức độ phân tử, Trung tâm nghiên cứu giống cây trồng rừng, Viện Khoa học Lâm nghiệp Việt Nam đang từng bước điều tra khảo sát tình trạng của một số giống cây quý hiếm và đặc hữu của Việt Nam, trong đó có cây bách xanh làm cơ sở cho công tác bảo tồn và tái tạo nguồn gen một cách có hiệu quả. Hiện nay, việc ứng dụng các kỹ thuật sinh học phân tử dựa trên phân tích RFLP, AFLP, RAPD, SSR,…để đánh giá mức độ đa dạng di truyền đã được áp dụng trên nhiều đối tượng cây trồng ở nhiều phòng thí nghiệm trên thế giới và Việt Nam (Kim et al., 2006; Mace et al., 1999; Powell et al., 1996, Đinh Thị Phòng và cs., 2004, Nguyễn Thị Hạnh, 2005). Trong đó, kỹ thuật RAPD (Random Amplified Polymorphic DNA) hay được sử dụng vì kỹ thuật này tương đối đơn giản, dễ thực hiện mà có hiệu quả (Ferreira et al., 1997; William et al., 1990). Chỉ thị DNA lục lạp có tính bảo thủ di truyền cao, di truyền theo đường mẹ, nên còn được sử dụng để nhận dạng các loài mới. Công trình này đề cập đến kết quả “Phân tích mối quan hệ di truyền tập đoàn giống cây bách xanh bằng chỉ thị RAPD và DNA lục lạp”, giúp cho công tác bảo tồn và tái tạo nguồn gen quý hiếm của Việt Nam.

Phương pháp nghiên cứu

Mẫu nghiên cứu gồm 20 mẫu lá bách xanh do Trung tâm nghiên cứu giống cây trồng rừng, Viện khoa học Lâm nghiệp Việt Nam cung cấp có ký hiệu và nơi thu thập như bảng 1.

Bảng 1. Nguồn gốc và ký hiệu 20 mẫu bách xanh dùng trong nghiên cứu

TT

Ký hiệu mẫu

Nguồn gốc

TT

Ký hiệu

mẫu

Nguồn gốc

TT

Ký hiệu

mẫu

Nguồn gốc

1

HT1

Hà Tây

8

LD1

Lâm Đồng

15

QB1

Quảng Bình

2

HT2

Hà Tây

9

LD2

Lâm Đồng

16

QB2

Quảng Bình

3

HT3

Hà Tây

10

LD3

Lâm Đồng

17

QB3

Quảng Bình

4

HT4

Hà Tây

11

LD4

Lâm Đồng

18

QB4

Quảng Bình

5

HT5

Hà Tây

12

LD5

Lâm Đồng

19

QB5

Quảng Bình

6

HT6

Hà Tây

13

LD6

Lâm Đồng

20

QB6

Quảng Bình

7

HT7

Hà Tây

14

LD7

Lâm Đồng

 

 

 

Các mồi sử dụng trong nghiên cứu gồm: 15 mồi RAPD (bảng 2) và 06 cặp mồi phân tích genome lục lạp với kích thước lý thuyết tương ứng (bảng 3).

Bảng 2. Trình tự các nucleotide 15 mồi RAPD sử dụng trong nghiên cứu

TT

Mồi

Trình tự nucleotide

TT

Mồi

Trình tự nucleotide

1

OPE14

5' TGC GGC TGAG 3'

9

RA143

5' TCGGCGATAG 3'

2

RA159

5’GTCCACACGG 3’

10

RA46

5’CCAGACCCTG 3’

3

RA142

5’CAATCGCCGT 3’

11

OPP19

5’GGG AAG GAC 3’

4

RA40

5’GGCGGACTGT 3’

12

OPB18

5'CCACAGCAGT 3'

5

OPP15

5'GGAAGCCAAC 3'

13

OPH08

5'GAAACACCCC 3'

6

OPN05

5'ACT GAA CGCC 3'

14

OPH03

5'AGA CGT CCAC 3'

7

OPA04

5'AATCGGGCTG 3'

15

UBC23

5' CCCGCCTTCC 3'

8

UBC3

5'CCT GGG CTTA 3'

 

 

 

Bảng 3. Trình tự các nucleotide của 06 cặp mồi phân tích genome lục lạp

TT

Tên mồi

Trình tự các nucleotide

Kích thước

lý thuyết

(bp)

1

Dal 1-F

Dal 1-R

5’CGAAATCGGTAGACGCTACG 3’

5’GGGGATAGAGGGACTTGAAC 3’

577

2

psaA-F

trnS-R

5’ ACTTCTGGTTCCGGCGAACGAA 3’

5’ AACCACTCGGCCATCTCTCCTA 3’

3681

3

trnS-F

trnfM-R

5’GAGAGAGAGGGATTCGAACC 3’

5’CATAACCTTGAGTCACGG G 3’

1254

4

rbcL1-F

rbcL2-R

5’ATGTCACCACAAACAGAAACTAAAGCAAGT 3’

5’CTTCACAAGCAGCAGCTAGTTCAGGACTCC 3’

1381

5

rps14-F

cob-R

5’CACGGGTCGCCCTCGTTCCG 3’

5’GTG TGG AGG ATA TAG GTT GT 3’

1396

6

trnH-F

trnK-R

5’ ACGGGAATTGAACCCGCGCA 3’

5’ CCGACTAGTTCCGGGTTCGA 3’

1831

Tách chiết DNA tổng số từ lá theo phương pháp CTAB của (Doyle and Doyle, 1987) có cải tiến. Kiểm tra độ sạch và hàm lượng DNA bằng đo quang phổ hấp thụ kết hợp với điện di trên gel agarose 0,8%. Kỹ thuật PCR – RAPD: hỗn hợp PCR có thể tích 25µl: bao gồm dung dịch đệm PCR 1X; 2,5mM MgCl2; 2mM dNTPs; 200nM đoạn mồi; 0,5 đơn vị Taq polymerase và 10ng DNA khuôn. PCR – RAPD thực hiên trong máy PCR – Thermal Cycler theo chu trình nhiệt: 940C trong 1 phút; 45 chu kỳ (920C trong 1 phút; 350C trong 1 phút; 720C trong 1 phút); 720C trong 10 phút; giữ sản phẩm ở 40C. Điện di sản phẩm PCR trên gel agarose 1,5%, nhuộm Ethidium bromide và chụp ảnh trên máy soi gel.

Phản ứng PCR với các cặp mồi lục lạp: hỗn hợp PCR với cặp mồi lục lạp có tổng thể tích là 25µl chứa: 1X dung dịch đệm PCR; 2,5mMgCl2; 2mM dNTPs; 0,5pmol mồi xuôi; 0,5pmol mồi ngược; 50ng DNA khuôn và 0,5 đơn vị Taq polymerase. Chu trình nhiệt của phản ứng là: 940C trong 2 phút; 35 chu kỳ (940C trong 1 phút; 500C - 600C trong 1 phút; 720C trong 1 phút); 720C trong 10 phút; giữ sản phẩm ở 40C. Điện di sản phẩm trên gel agarose 1%, nhuộm Ethidium bromide và chụp ảnh trên máy soi gel. Phản ứng cắt enzyme hạn chế: sản phẩm PCR của các cặp mồi lục lạp được cắt bằng các enzyme hạn chế thành phần gồm: 10µl sản phẩm PCR, 2µl 10X buffer, 2µl enzyme và 6µl H2O. Phản ứng cắt được thực hiện ở 37oC trong vòng 12h đến 16h. Phân tích số liệu: theo quy ước: 1 = phân đoạn DNA xuất hiện và 0 = phân đoạn DNA không xuất hiện, khi điện di sản phẩm RAPD với các đoạn mồi ngẫu nhiên. Xác định hệ số di truyền giống nhau, giá trị PIC, giá trị trương quan kiểu hình (r),... để lập ra biểu đồ so sánh hệ số tương đồng di truyền giữa 20 mẫu bách xanh ở mức độ phân tử như trong công trình nghiên cứu của Đinh Thị Phòng và cộng sự, 2004. Số liệu được xử lý bằng chương trình NTSYSpc version 2.0 (Applied Biostatistics Inc., USA., 1998).

Kết quả nghiên cứu

Phân tích đa dạng di truyền tập đoàn giống cây bách xanh: DNA của 20 mẫu bách xanh được phân tích với 15 mồi ngẫu nhiên RAPD. Kết quả phân tích sản phẩm PCR - RAPD điện di trên gel agarose 1,5% cho thấy, có 9/15 mồi chỉ ra tính đa hình với giá trị PIC dao động từ 0,08 (RA40) đến 0,31 (RA46). Số lượng các phân đoạn DNA nhân bản với mỗi mồi từ 2 đến 11 phân đoạn. Kích thước các phân đoạn DNA được nhân bản trong khoảng từ 200 bp đến 1800 bp. Tổng số phân đoạn DNA nhân bản được của 20 mẫu bách xanh với 15 mồi RAPD là 854. Số phân đoạn ADN nhân bản được nhiều nhất là 104 phân đoạn (RA40) và ít nhất là 20 phân đoạn (UBC23) (bảng 4). Tính đa hình thể hiện ở sự xuất hiện hay không xuất hiện phân đoạn DNA khi so sánh giữa các mẫu với nhau. Tổng số phân đoạn DNA khi phân tích với 15 mồi ngẫu nhiên là 56 phân đoạn. Trong đó có 22 phân đoạn là đa hình (chiếm 39,29%) và 34 phân đoạn đơn hình (chiếm 60,71%).

Bảng 4. Giá trị PIC và tỉ lệ phân đoạn đa hình của 20 mẫu bách xanh phân tích với 15 mồi ngẫu nhiên RAPD

TT

Mồi

PIC

Phân đoạn đa hình

Phân đoạn đồng hình

Tổng số

phân đoạn

% phân

đoạn đa

hình

1

OPE14

0

0

3

3

0,00

2

RA159

0,46

6

0

6

100,00

3

RA142

0

0

3

3

0,00

4

RA40

0,08

1

5

6

16,67

5

OPP15

0

0

3

3

0,00

6

OPN05

0

0

2

2

0,00

7

OPA04

0,16

2

1

3

66,67

8

UBC3

0,08

1

1

2

50,00

9

RA143

0

0

2

2

0,00

10

RA46

0,31

4

1

5

80,00

11

OPP19

0,08

1

4

5

20,00

12

OPB18

0,20

2

3

5

40,00

13

OPH08

0,13

2

3

5

40,00

14

OPH03

0,13

3

2

5

60,00

15

UB23

0

0

1

1

0,00

Tổng

 

 

22

34

56

39,29

Kết quả điện di sản phẩm PCR của 20 mẫu bách xanh phân tích với mồi RA40 làm đại diện cho kết quả phân tích với các mồi ngẫu nhiên và được trình bày ở hình 1A. Trong số 5 phân đoạn DNA được nhân bản thì có 4 phân đoạn đa hình (chiếm 80%). Các phân đoạn có kích thước khoảng từ 0,3 kb đến 1,0 kb. Tính đa hình DNA của các mẫu được thể hiện tương đối rõ. Ví dụ ở vị trí khoảng 0,7 kb (mũi tên: ←) 6 mẫu bách xanh QB1, QB2, QB3, QB4, QB5 và QB6 (giếng 15, 16, 17, 18, 19 và 20, tương ứng) đã xuất hiện phân đoạn DNA mới. Điều đáng luu ý là các mẫu thu được ở cùng một địa phương cũng có sự đa hình, chẳng hạn như tại vị trí khoảng 0,8 kb, mẫu HT1, HT2 và HT3 (giếng 1, 2 và 3, tương ứng) đã xuất hiện phân đoạn DNA; hoặc mẫu HT4, HT5, HT6 và HT7 (giếng 4, 5, 6 và 7, tương ứng) đã không xuất hiện phân đoạn DNA (mũi tên →). Kết quả nhận được cho thấy trong tập đoàn 20 mẫu bách xanh nghiên cứu đã có sự sai khác trong DNA genome nhân. Tuy nhiên, khi phân tích với mồi OPP15 có 3 phân đoạn DNA được nhân bản, nhưng lại không chỉ ra tính đa hình giữa 20 mẫu bách xanh (hình 1B).


Hình 1: Điện di sản phẩm PCR – RAPD trên gel 1,5 % agarose (A: Mồi RA46 và B: Mồi OPP15; M: marker phân tử 1kb; Giếng 1-20:tên của 20 mẫu bách xanh như trong bảng 1).

Mối quan hệ di truyền của 20 mẫu cây bách xanh với 15 mồi RAPD: Mối quan hệ di truyền của 20 mẫu bách xanh thu được ở 3 địa phương Hà Tây, Lâm Đồng và Quảng Bình được thể hiện trên sơ đồ hình cây (hình 2A) đã phân ra làm 3 nhánh rõ ràng. Hệ số tương đồng di truyền của 20 mẫu bách xanh dao động từ 0,75 đến 1. Điều đáng lưu ý ở đây, hầu hết các mẫu có cùng vùng địa lý thu mẫu đều lập thành một nhánh trên cây phân loại: Nhánh I gồm 7 mẫu bách xanh thu được tại Hà Tây (kí hiệu HT1, HT2…HT7) có mức độ tương đồng di truyền trong khoảng từ 0,882 đến 0,98; Nhánh II gồm 7 mẫu thu được tại Lâm Đồng (kí hiệu LD1, LD2…LD7) có mức độ tương đồng di truyền trong khoảng 0,853 đến 0,954; Nhánh III gồm 6 mẫu thu được tại Quảng Bình (kí hiệu QB1, QB2…QB6) và có mức độ tương đồng di truyền khoảng từ 0,88 đến 1. Trong đó hai giống QB5 và QB6 giống nhau hoàn toàn nên có hệ số tương đồng di truyền là 1. Kết quả phân nhóm theo toạ độ cũng phản ánh kết quả tương tự (hình 2 B).


Hình 2: Biểu đồ hình cây (A) và biểu đồ toạ độ (B) của 20 mẫu bách xanh theo hệ số di truyền của Jaccard và kiểu phân nhóm UPGMA

Phân tích đa hình DNA lục lạp của 20 mẫu bách xanh bằng chỉ thị lục lạp: Song song với việc đánh giá đa dạng genome nhân bằng các chỉ thị RAPD, trong nghiên cứu này, 06 cặp mồi lục lạp cũng đã được sử dụng để đánh giá sự đa dạng di truyền ở DNA lục lạp, nhưng chỉ có 4 cặp mồi (Dal1R-Dal1F, trnS–trnfM, rbcL1- rbcL2 và rpS14-cob) là nhân được sản phẩm PCR. Trong đó hai cặp mồi Dal1R-Dal1F và trnS–trnfM đã nhân bản được phân đoạn DNA có độ dài khoảng 500 bp (hình 3A) và 950 bp (hình 3B), tương ứng. Hai cặp mồi rbcL1- rbcL2 và rpS14-cob) cũng đã nhân bản được phân đoạn DNA có độ dài khoảng 900 kb (hình 3C) và 1kb (hình 3D). Tuy nhiên, điều đáng quan tâm ở đây là sản phẩm PCR của 4 cặp mồi lục lạp khi phân tích với 20 mẫu bách xanh đã không chỉ ra tính đa hình (các mẫu bách xanh đều nhân được các phân đoạn DNA có kích thước bằng nhau). Kết quả này cũng đồng nghĩa là sử dụng các cặp mồi trên không bộc lộ được sự đa hình DNA genome lục lạp giữa các mẫu bách xanh.


Hình 3: Điện di sản phẩm PCR phân tích với các cặp mồi Dal1F - Dal1R (A), trnS - trnfM (B); rbcL1 - rbcL2 (C) và rps14-cob (D); M: thang phân tử chuẩn 1kb, giếng 1-20: thứ tự sắp xếp của các mẫu bách xanh như trong bảng 1. 

Để có cơ sở đánh giá thêm về tính đa hình DNA lục lạp của 20 mẫu bách xanh, chúng tôi đã sử dụng 09 enzyme hạn chế để cắt sản phẩm PCR lục lạp đối với một số mẫu bách xanh của mỗi địa phương khi phân tích với 4 cặp mồi nêu trên. Tính đa hình được thể hiện nếu sản phẩm PCR bị cắt thành các đoạn DNA có kích thước khác nhau. Phương pháp này đã được nhiều tác giả sử dụng trong nghiên cứu đa dạng di truyền và phát sinh loài (Chung et al., 2003; Mohanty et al., 2001, Devos et al., 2003; McMillan et al., 2004).

Kết quả cắt enzyme hạn chế: sản phẩm PCR thu được từ 04 cặp mồi trên đây đã được xử lý với 09 enzyme hạn chế EcoRI, NdeI, XhoI, SacI, KpnI, PstI, X-baI, BamHI, HindIII, nhưng đã không chỉ ra các đoạn cắt đa hình và cho thấy sự bảo thủ di truyền rất cao trong hệ genome lục lạp ở cây bách xanh.

Kết luận

Mười năm mồi ngẫu nhiên dùng đề phân tích tính đa hình DNA genome của 20 mẫu bách xanh thì có 9 mồi chỉ ra tính đa hình. Trong phạm vi vùng phân tích có 56 phân đoạn DNA được nhân bản, số lượng các phân đoạn DNA nhân bản với mỗi mồi từ 2 đến 11 phân đoạn. Kích thước phân đoạn DNA được nhân bản trong khoảng từ 200 bp đến 1800 bp. Hệ số sai khác di truyền của 20 mẫu bách xanh dao động từ 0,75 đến 1 và được phân làm 3 nhánh chính: nhánh I gồm 7 mẫu thu tại Hà Tây, nhánh II gồm 7 mẫu thu tại Lâm Đồng và nhánh III gồm 6 mẫu thu tại Quảng Bình. Sáu cặp mồi lục lạp dùng để phân tích đa hình DNA lục lạp, nhưng chỉ có 04 cặp mồi lục lạp nhân được sản phẩm PCR. Chín enzyme cắt hạn chế sử dụng cho phân tích đa hình sản phẩm PCR nhưng đã không chỉ ra tính đa hình.

Lời cảm ơn: Công trình này được hoàn thành nhờ kinh phí của đề tài “Bảo tồn nguồn gen của Viện Khoa học và lâm nghiệp Việt Nam” giai đoạn 2007-2010. Các tác giả xin chân thành cảm ơn Phòng Công nghệ Tế bào thực vật, Viện Công nghệ Sinh học về việc sử dụng một số trang thiết bị.

Tài liệu tham khảo

1.      Chung S M., E. S. Jack, 2003: The development and evaluation of consensus chloroplast primer pairs that possess highly variable sequence regions in a diverse array of plant taxa. Theor Appl Genet 107: 757-767.
2.      Đinh Thị Phòng, Lê Trần Bình, Lê Thị Muội, Nguyễn Thị Hải Hà, Lê Duy Thành, Nguyễn Văn Viết, 2004: Nghiên cứu đa dạng tập đoàn giống lúa có tính kháng khác nhau với bệnh bạc lá lúa vi khuẩn Xanthomonas oryzae bằng kỹ thuật RAPD. Báo cáo khoa học Hội nghị toàn quốc về Những vấn đề nghiên cứu cơ bản trong khoa học sự sống định hướng nông lâm nghiệp miền núi. 571-574.
3.      Devos N., D. Tyteca, O. Raspe, R. A. Wesselingh, A. L. Jacquemart, 2003: Patterns of chloroplast diversity among western European Dactylorhiza species (Orchidaceae). Plant Syst Evol., 243: 85-97.
4.      Doyle J. J., 1987: Rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 19: 11-15.
5.      Ferreira A. R., P. Keim, 1997: Plant Mol Biol Rep, 15(4): 335- 354.
6.      Kim M. K.,  M. J. Park,  W. H. Jeong, K. C. Nam, J. Chung, 2006: SSR marker tightly linked to the Ti locus in Soybean [Glycine max (L.) Merr.]. Euphytica 152(3): 361-366.
7.      Mace E. S.,  R. N. Lester,  C. G. Gebhardt, 1999: Theor. Appl. Genet. 99: 626 - 633.
8.      McMillan E.,  G. Sun, 2004: Theor Appl Gent 108: 535-542.
9.      Mohanty A.,  J. P. Martin,  I. Aguinagalde, 2001: Theor Appl Genet 103: 112-117.
10.  Powell W, M. Morgante, C. Andre, M. Hanafey, J. Vogel, S. Tingey,  A. Rafalski, 1996: The comparison of RFLP, RAPD, AFLP and SSR markers for germplasm analysis. Molecular Breeding 2(3): 225 - 238.
11.  Williams J. G. K., A. R. Kubelik, K. J. Livak, J. A. Rafalski, S. V. Tingey, 1990: DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 18: 6531-6535.

Vũ Thị Thu Hiền, Trần Thị Việt Thanh, Đinh Thị Phòng
Bảo tàng Thiên nhiên Việt Nam
Lê Anh Tuấn, Phí Hồng Hải
Trung tâm Nghiên cứu giống cây trồng rừng
(Tuyển tập báo cáo Hội nghị Sinh thái và Tài nguyên sinh vật lần thứ 3, 22/10/2009 - Viên ST&TNSV - Viện KH&CN Việt Nam)

anhtai.bvn

Đánh giá:      Google Bookmarks Facebook Twitter   Gửi email     Bản để in     Phản hồi

SÁCH THAM KHẢO

CÁC BÀI MỚI HƠN:
CÁC BÀI ĐĂNG TRƯỚC:
TIN BÀI MỚI NHẤT


ĐƯỢC XEM NHIỀU NHẤT

SÁCH THAM KHẢO

LIÊN KẾT WEBSITE

 
 
 
 
 
 
 

TỪ KHÓA

BVN - BotanyVN - Botany Research and Development Group of Vietnam
(©) Copyright 2007-2019