Trang chủ   Tin tức   Cơ sở dữ liệu    Đăng ký   Giới thiệu   Tìm kiếm: 
Infinite Menus, Copyright 2006, OpenCube Inc. All Rights Reserved.

Tương thích với


Mối quan hệ di truyền của một số loài Thông (Coniferales) ở Việt Nam trên cơ sở xác định trình tự Nucleotide vùng gene RBCL (Rubilose-1,5Bisphophate Carboxylase)

Cập nhật ngày 20/10/2013 lúc 6:10:00 PM. Số lượt đọc: 2798.

Một số nghiên cứu về cây phát sinh phả hệ trên cơ sở vùng gen 18S và 28S đã chỉ ra mối quan hệ di truyền của 7 họ thuộc bộ cây lá kim Coniferales (Chaw và cộng sự, 1995; 1997; Stefanovic và cộng sự, 1998). Cheng và cộng sự (2000) đã sử dụng gen lục lạp và ITS để xác định mức độ tiến hoá của 6 chi, Taxus, Pseudotaxus, Austrotaxus, Amentotaxus, Torreya và Cephalotaxus thuộc 2 họ Taxaceae và Cephalotaxaceae. Little (2006) kết hợp các đặc điểm giải phẫu, sinh hoá, hình thái vi cấu trúc cùng với dẫn liệu sinh học phân tử vùng gen MatK, NEEDLY intro2, ITS, rbcL và trnl đã xây dựng mối quan hệ tiến hoá trong họ phụ Cupressoidae. Tam và Trang (2010) đã sử dụng vùng gen 18S để xác định mối quan hệ tiến hoá của 6 chi thuộc họ Hoàng đàn Cupressaceae ở Việt Nam. Trong báo cáo này chúng tôi đề cập đến quan hệ của 18 loài cây lá kim thuộc bộ Cây lá kim trên cơ sở phân tích trình tự nucleotide vùng gen rbcL.


Bảng 1. 17 loài Thông được sử dụng cho phân tích DNA 




Tổng số 18 mẫu lá hoặc vỏ cây từ 17 loài thuộc 5 họ của bộ cây lá kim sử dụng trong nghiên cứu này được thu thập vào năm 2009, 2010 và năm 2011 (bảng 1), được bảo quản tại phòng Phân loại học Thực nghiệm và Đa dạng nguồn gen của Bảo tàng Thiên nhiên Việt Nam.

DNA tổng số được tách chiết từ lá hoặc vỏ cây tươi bằng phương pháp CTAB (Doyle và Doyle, 1990) có cải tiến. PCR (polymerase chain reaction) được tiến hành cùng cặp mồi rbcL (với kích thước lý thuyết là 900bp) có trình tự rbcL-F: 5’- CACTGTTTGGACCGATGGACT TAC-3’ và rbcL-R: 5’- CTTCGCGGATCACTTCATTACCTTC-3’. Nhân bản DNA được tiến hành trên máy Gen Amp PCR systems 9700 theo chu trình sau: 94oC: 3 phút; tiếp theo 40 chu kỳ 94oC: 1 phút, 55oC: 1 phút, 72oC: 1 phút, chu kỳ cuối 72oC: 10 phút. Điện di sản phẩm PCR trên gel agarose 1% trong 40ml dung dịch đệm 1xTAE. Sản phẩm PCR được tinh sạch bằng Purification Kít (Hãng QIAGEN), giải trình tự sử dụng với kít BigDye terminator v3.1 với mồi xuôi rbcL1-F và máy Avant 3100 Automated DNA sequencer …

So sánh sự khác nhau về vị trí các nucleotide giữa các cặp loài dùng ClustalW (Thomas và cộng sự, 1994) và phần mềm MEGA4 (Tamura và cộng sự, 2007) được sử dụng để phân tích dữ liệu. Cây phát sinh chủng loại được xây dựng theo phương pháp NJ (Neighbor Joining).


Chiều dài vùng gen rbcL khoảng 861bp đã được xác định cho 17 loài thông nghiên cứu. Sau khi loại bỏ tất cả các vị trí trống, 861 vị trí có giá trị được sử dụng cho phân tích. Trong số 180 vị trí biến đổi (Variable), giá trị mang thong tin tiến hóa (Parsimony informative) chiếm 148 vị trí. Số cặp nucleotide tương đồng trung bình 681. Số cặp tương đồng cao nhất là 285 xuất hiện ở vị trí codon thứ 1 và thấp nhất là 237 ở vị  trí codon thứ 2. Hệ số trung bình của các cặp đồng hoán (transition) và dị hoán (transversion) là 2,9. Giá trị này đối với vị trị codon thứ nhất, thứ hai và thứ ba là 0,4; 3,5 và 1,8, tương ứng.

Không có sự khác nhau về trình tự nucleotide trong 2 cặp loài, Thông đỏ bắc (Taxus chinensis)/Thông đỏ nam (T. wallichiana) và Bách xanh núi đá (Calocedrus macrolepis)/ Bách xanh núi đất (C. rupestris). Có sự khác nhau giữa các loài trong cùng chi, như Thông tre lá ngắn (Podocarpus pilgeri) và Thông tre lá dài (P. nerifoliuss) có 6 vị trí và cặp loài Kim giao bắc (N. fleuryi) và Kim giao nam (N. wallichiana) có 20 vị trí. Hai mẫu của loài Hoàng đàn (C. tonkinensis) - Hoàng đàn rủ và Hoàng đàn tía chỉ có 1 vị trí khác nhau. Thành phần bazơ của 17 loài thông nghiên cứu được trình bày ở bảng 2.

Phân tích mối quan hệ di truyền trên cơ sở dữ liệu vùng gen rbcL của 18 mẫu thuộc 17 loài Thông theo phương pháp NJ ( Neighbor Joining) đã chỉ ra mối quan hệ giữa các loài Thông (Hình 1). Ba nhánh tiến hóa được tách biệt rõ ràng: nhánh thứ nhất gồm 5 loài thuộc họ Kim giao (Podocarpaceae); nhánh thứ hai gồm 3 loài thuộc họ Thông (Pinaceae); nhánh thứ ba gồm các loài của 3 họ Thông đỏ (Taxaceae), họ Hoàng đàn (Cupressaceae) và họ Bụt mọc (Taxodiaceae). Trong nhánh này gồm 2 nhánh phụ, một nhánh gồm 3 loài thuộc họ Thông đỏ (Taxaceae), trong đó thông đỏ nam (T. wallichiana) và thông đỏ bắc (T. chinensis) có quan hệ mật thiết với nhau với giá trị bootstrap 100%). Nhánh phụ còn lại gồm 7 loài thuộc 2 họ còn lại, trong đó loài Sa mu dầu (Cunninghamia konishii) thuộc họ Bụt mọc (Taxodiaceae) tách riêng rẽ ra so với 6 loài thuộc họ Hoàng đàn (Cupressaceae). Trong họ Hoàng đàn, loài Bách xanh núi đất (C. macrolepis) và bách xanh núi đá (C. rupestris) có quan hệ mật thiết với nhau với giá trị bootstrap (100%); Mẫu Hoàng đàn rủ và Hoàng đàn tía (C. tonkinensis) có quan hệ mật thiết với nhau với giá trị bootstrap (99%). Kết quả phân tích mối quan hệ giữa các họ trong bộ cây lá kim cũng phù hợp với công bố của các tác giả khác (Chaw và cộng sự, 1995; 1997; Stefanovic và cộng sự, 1998).

Bảng 2. Thành phần base (%) trong vùng gen rbcL của 18 loài thông



Hình 1. Mối quan hệ di truyền của 17 loài thông theo phương pháp NJ


Đã giải trình tự một vùng gen rbcL có chiều dài 861bp từ 17 loài thông nghiên cứu. Xây dựng cây tiến hóa phân tử từ các số liệu trình tự này cho thấy các loài nghiên cứu tách thành 3 nhánh tiến hóa rõ ràng: nhánh thứ  nhất gồm các loài thuộc họ Kim giao (Podocarpaceae); nhánh thứ hai gồm các loài thuộc họ Thông (Pinaceae); nhánh thứ ba gồm các loài của 3 họ Thông đỏ (Taxaceae), họ Hoàng đàn (Cupressaceae) và họ Bụt mọc (Taxodiaceae). 3 cặp loài có quan hệ rất gần nhau gồm: Thông đỏ bắc (Taxus chinensis) và Thông đỏ nam (T. wallichiana), Bách xanh núi đá (Calocedrus macrolepis) và bách xanh núi đất (Ca. rupestris) và 2 mẫu Hoàng đàn tía (Cupressus tonkinensis) và Hoàng đàn rủ (C. tonkinensis). Với kết quả này, chúng tôi cho rang nên nhập loài thông đỏ nam và loài thông đỏ bắc vào cùng tên T. chinensis,  loài Bách xanh núi đất và loài Bách xanh núi đá vào chung một tên là Bách xanh (C. macrolepis), Hoàng đàn tía và loài Hoàng đàn rủ vào một loài C. tonkinensis.

Lời cám ơn. Báo cáo này là một phần của dự án BVMT  ”Bảo tồn và sử dụng bền vững một số loài thông quý hiếm có giá trị kinh tế cao đang bị đe dọa tuyệt chủng và khu hệ nấm nội ký sinh có ích trong các loài nghiên cứu”.


1. Hiep  N. T., P. K. Loc, N. D. T. Luu, P. L. Thomas, A. Farjon, L. Averyanov, J. Jr. Regalado, 2004: Thông Việt Nam: Nghiên cứu hiện trạng và bảo tồn 2004, Fauna & Flora International, Chương trình Việt Nam, Hà Nội, tr. 55-56.
2. Chaw  S. M., H. M. Sung, H. Long, A. Zharkikh, W. H. Li, 1995: J.  Mol.  Evol., 41: 224-230.
3. Chaw S. M., A. Zharkikh, H. M. Sung, T. C. Leu, W. H. Li., 1997: Mol. Biol. Evol., 14: 56-68.
4. Stefanovic S., M. Jager, J. Deutsch, J. Broutin, M. Masselot, 1998: Amer. J. Bot., 85(5): 688-697.
5. Cheng Y., R. G. Nicolson, K. Tripp, S. M. Chaw., 2000: Mol. Phyl. & Evol., 14(3): 353-365.
6. Little D. P., A. E. Schwarzbach, R. P. Adams, C. F. Hsieh, 2004: Amer. J. Bot., 91: 1872-1881.
7. Little D. P., 2006: Systematic Botany, 31(3): 461-480
8. Xiang Q. & J. Li, 2005: Harward papers in Botany, 9: 375-382
9. Nguyễn Minh Tâm, Vũ Đình Duy, Dương Văn Tăng, Nguyễn Tiến Hiệp, Nguyễn Sinh Khang, 2011: Hội nghị toàn quốc lần thứ nhất Hệ thống Bảo tàng Thiên nhiên Việt Nam, NXB. KHTN&CN, Hà Nội, tr. 189-194.
10. Doyle J. J., D. J. Doyle, 1990: Pocus, 12: 365-371.
11. Thompson J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, D. G. Higgins, 1997: Nucleic Acids Research, 25: 4876-4882.
12. Tamura K., J. Dudley, M. Nei, S. Kumar, 2007: Molecular biology and Evolution, 10: 1093.

Vũ Đình Duy, Nguyễn Minh Tâm
Bảo Tàng thiên nhiên Việt Nam
Bùi Thị Tuyết Xuân, Đỗ Hữu Thư
Viện Sinh thái và Tài nguyên sinh vật
Nguyễn Minh Đức
Trường Đại học Phương Đông

(Tuyển tập Hội nghị toàn quốc về Sinh thái và Tài nguyên sinh vật lần thứ IV, Hà Nội 2011)

Đánh giá:      Google Bookmarks Facebook Twitter   Gửi email     Bản để in     Phản hồi








    BVN - BotanyVN - Botany Research and Development Group of Vietnam
    (©) Copyright 2007-2023