Trang chủ   Tin tức   Cơ sở dữ liệu    Đăng ký   Giới thiệu   Tìm kiếm: 
Infinite Menus, Copyright 2006, OpenCube Inc. All Rights Reserved.

Tương thích với

TIN TỨC > PHÂN LOẠI THỰC VẬT

Mối quan hệ di truyền của một số loài Lan hài thuộc chi Paphiopedilum ở Việt Nam

Cập nhật ngày 23/10/2009 lúc 11:17:00 AM. Số lượt đọc: 2958.

Việt Nam là một trung tâm Lan hài lớn của thế giới, với trên 20 loài thuộc chi Paphiopedilum, trong số đó có nhiều loài là đặc hữu. Lan hài sống tự nhiên chỉ còn tồn tại ở một vài vùng rừng nguyên sinh của Việt Nam. Lan hài có giá trị về mặt thẩm mĩ, khoa học và mang lại giá trị kinh tế cao. Khi được phát hiện, nhiều loài Lan hài đã sớm bị săn tìm và thu hái khiến cho số lượng của chúng bị suy giảm nhanh chóng, dẫn đến một số loài đã và đang có nguy cơ bị tuyệt chủng

Hiện nay, các loài Lan hài thuộc chi Paphiopedilum đã được xếp vào nhóm nghiêm cấm khai thác, sử dụng vì mục đích thương mại (IA) trong Nghị định số 32/2006/NĐ-CP ngày 30/3/2006 của Chính phủ, vì vậy việc bảo tồn các loài Lan hài đang là mối quan tâm của các nhà khoa học. Các kỹ thuật sinh học phân tử hiện đã được ứng dụng phổ biến trong công tác phân loại, đánh giá mối quan hệ di truyền các loài sinh vật, từ đó có cơ sở chắc chắn phục vụ cho công tác bảo tồn và phát triển bền vững. Van den Berg et al. (2005) sau khi nghiên cứu cây phát sinh chủng loại của Epidendreae và Arethuseae (Orchidacae) trên cơ sở phân tích sự sai khác trên vùng ITS-rDNA, vùng không phiên mã trnL, vùng trnL-F, gen matK và vùng rbcL đã chứng minh rằng vùng ITS-rDNA (ITS1-5.8S-ITS2) chứa đựng nhiều khác biệt nên có thể dùng để phân loại các loài hoặc chủng gần nhau và nghiên cứu mối quan hệ họ hàng. Trong nghiên cứu này, chúng tôi định loại một số loài Lan đặc hữu ở Việt Nam và nghiên cứu mối liên hệ với các loài Lan trên thế giới trên cơ sở phân tích đoạn ITS để tạo cơ sở cho công tác bảo tồn bền vững cho các loài có nguy cơ tuyệt chủng.

Phương pháp nghiên cứu

Sáu mẫu lá non thu ngoài thực địa được giữ tạm thời trong silicagen sau đó chuyển sang bảo quản lạnh ở -70°C. Mẫu lá đem nghiền với nitrogen lỏng (-196°C) sau đó chiết và tinh sạch DNA tổng số bằng Dneasy Plant Mini Kit (Qiagen). Sử dụng kỹ thuật PCR nhân bản vùng gen ITS-rDNA với PCR Taq Mastermix (Qiagen) và cặp mồi có trình tự như sau:

17SE: 5’-ACGAATTCATGGTCCGGTGAAGTGTTCG-3’

và 26SE: 5’-TAGAATTCCCCGGTTCGCTCGCCGTTAC-3’.

Chu trình PCR thực hiện trên máy Eppendorf Mastercycle theo các bước: biến tính 94°C trong 3 phút; tiếp theo là 35 chu kỳ 94°C trong 1 phút, 58°C trong 1 phút và 72°C 2 phút; cuối cùng chu trình kết thúc ở 72°C 10 phút. Sản phẩm PCR được điện di trên gel agarose 1,5% trong đệm TBE, nhuộm Ethidium Bromide và quan sát dưới bước sóng 302nm. Vạch sản phẩm đặc hiệu có chiều dài khoảng 750bp được cắt và tinh sạch bằng MinElute Gel Extraction Kit (Qiagen). Giải mã các đoạn DNA bằng BigDye Terminator Cycle Sequence Kit v3.1 (Applied Biosystems), tinh sạch sản phẩm với Centri-Sep spin column (Applied Biosystems) và đọc trình tự trên hệ thống phân tích trình tự tự động ABI 3100 – Avant Genetic Analyzer (Applied Biosystems). Kết quả giải mã được gửi lên ngân hàng dữ liệu thông tin di truyền Genbank với số truy cập là FJ712267-FJ712272.

Phân tích kết quả: So sánh kết quả giải mã vùng ITS-rDNA với trình tự của 83 loài trong chi Paphiopedilum từ dữ liệu trên Genbank và loài ngoài nhóm Mexipedium xerophyticum bằng phần mềm ClustalX v1.81. Xây dựng cây phát sinh chủng loại theo phương pháp Maximum parsimony (MP) và phân tích kết quả bằng phần mềm PAUP v4.0 (Swofford 2002).

Kết quả nghiên cứu

1. Đối chiếu trình tự nucleotit 6 mẫu Lan hài của Việt Nam

P.villosum      : TTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCAGTTTACTT :  50

P.villosum671   : .................................................. :  50

P.tranlienianum : .................................................. :  50

P.hangianum     : ................................CA................ :  50

P.malipoense    : ................................CA................ :  50

P.micranthum564 : ........G.......................CA.......G........ :  50

                                                                      

P.villosum      : TGGTCACCCATGGGCATTTGCTATT-GCAGTGACCGAGATTTGCCATCGA :  99

P.villosum671   : .........................-........................ :  99

P.tranlienianum : .........................-........................ :  99

P.hangianum     : ...............GC........-..G......T...........G.. :  99

P.malipoense    : C..............GC........T..G......T...........G.. : 100

P.micranthum564 : .........T.....GC........-..G......T...........G.. :  99

                                                                      

P.villosum      : G----CCTCCTTGGGAGCTTTCTTGCTGGCGATCTAAACCCTAGCCCGGC : 145

P.villosum671   : .----............................................. : 145

P.tranlienianum : .----............................................. : 145

P.hangianum     : .----.....................C........-......T....... : 144

P.malipoense    : .----.....................C........T......T....... : 146

P.micranthum564 : .GGAG.....................C........-......T....... : 148

                                                                         

P.villosum      : GCAGTTTTGCGCCAAGTCATATGACACATAATTGGCGAAGG--------- : 186

P.villosum671   : .........................................--------- : 186

P.tranlienianum : ...................................T.....--------- : 186

P.hangianum     : ...................................T.G...GCATAGCCC : 194

P.malipoense    : .....................A...................--------- : 187

P.micranthum564 : ...................................T.....GCATAGCCC : 198

                                                                          

P.villosum      : ------------------GGGCGGCATGGTGCCTTGACCCT--------- : 209

P.villosum671   : ------------------.......................--------- : 209

P.tranlienianum : ------------------.......................--------- : 209

P.hangianum     : TTTGTGAATTCAAGGAGG..........TG...........ACACTCGCT : 244

P.malipoense    : ---------------AGG..........TG...........ACATTCACT : 222

P.micranthum564 : TTCGTGAATTCGAGGAGG..........TG.........----------- : 237

                                                                          

P.villosum      : CCCC------AAATTATTTTTT--AACAACTCTCAGCAACGGATATCTCG : 251

P.villosum671   : ....------............--.......................... : 251

P.tranlienianum : ....------............--.......................... : 251

P.hangianum     : ....C-TCTCG.........C.-G.......................... : 292

P.malipoense    : ....CCTCTC............TG.......................... : 272

P.micranthum564 : ------TCTCT...........-G.......................... : 280

                                                                          

P.villosum      : GCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATT : 301

P.villosum671   : .................................................. : 301

P.tranlienianum : .................................................. : 301

P.hangianum     : ......................................G........... : 342

P.malipoense    : ......................................G........... : 322

P.micranthum564 : ......................................G........... : 330

                                                                          

P.villosum      : GCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGC : 351

P.villosum671   : .................................................. : 351

P.tranlienianum : ......................T.T......................... : 351

P.hangianum     : ....G............................................. : 392

P.malipoense    : ....G........................................A.... : 372

P.micranthum564 : .............................................A.... : 380

                                                                          

P.villosum      : CATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATATCTCTCCC : 401

P.villosum671   : .................................................. : 401

P.tranlienianum : .....................C.T.....................T.... : 401

P.hangianum     : .................................................. : 442

P.malipoense    : .................................................. : 422

P.micranthum564 : .................................................. : 430

                                                                          

P.villosum      : TTAATGAGGCTGTCCACACATACTGTTCAGCCGGTGCGGATGTGAGTTTG : 451

P.villosum671   : .................................................. : 451

P.tranlienianum : ................TC................................ : 451

P.hangianum     : ................TG................................ : 492

P.malipoense    : .............A..TG................................ : 472

P.micranthum564 : ................TG................................ : 480

                                                                         

P.villosum      : GCCCCTTGTTCATTGGTACGGGGGGTCTAAGAGCTGCGTGGGCTTTTGTT : 501

P.villosum671   : .................................................. : 501

P.tranlienianum : ................................................A. : 501

P.hangianum     : ...........T.....G.T..............A..AG.........A. : 542

P.malipoense    : ...........T.C...G.T.................AG.........A. : 522

P.micranthum564 : ...........T.....G.T..............Y..AG.........A. : 530

                                                                         

P.villosum      : GGTCCTAAATACGGCAAGAGGTGGACGAACTATGCTACAACAAAACTGTT : 551

P.villosum671   : .................................................. : 551

P.tranlienianum : .............................T....T............... : 551

P.hangianum     : ..........T..................TC................... : 592

P.malipoense    : ..........T..................T-----............... : 567

P.micranthum564 : ..........T..................TC................... : 580

                                                                         

P.villosum      : GTGCGAATGCCCCGGGTTGTCGTATTAGATGGGCCAGCATAATCTAAAGA : 601

P.villosum671   : .................................................. : 601

P.tranlienianum : .............................N.................... : 601

P.hangianum     : ..........T..A................................G... : 642

P.malipoense    : ..........T..A.................................... : 617

P.micranthum564 : ..........T..A......................T.........G... : 630

                                                                         

P.villosum      : CCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCC : 651

P.villosum671   : .................................................. : 651

P.tranlienianum : .................................................. : 651

P.hangianum     : .....GG........................................... : 692

P.malipoense    : .....G.........C.......A.........G................ : 667

P.micranthum564 : .....G............................................ : 680

 

P.villosum      : ATTTGGTT : 659

P.villosum671   : ........ : 659

P.tranlienianum : ........ : 659

P.hangianum     : ...C.... : 700

P.malipoense    : ........ : 675

P.micranthum564 : T....... : 688

Vùng ITS-rDNA của 5 loài Lan hài ở Việt Nam dao động từ 659bp (P. villosum) đến 700bp (P. hangianum). Giữa hai mẫu P. villosum lấy từ hai cây riêng biệt hoàn toàn không có sự sai khác nào. Chúng tôi sử dụng một số trình tự của các loài Lan hài P. villosum (mã hiệu Z78483) P. hangianum (mã hiệu EF156194, EF156109), P. micranthum (mã hiệu EF156227, EF156228 Z78499), P. tranlienianum (mã hiệu EF156236, EF156151, EF156066), P. malipoense (mã hiệu AJ564357, FJ899755, Z78498) trên Genbank để đối chiếu trình tự nucleotide. Kết quả cho thấy chiều dài đoạn ITS-rDNA của các mẫu Lan hài ở Việt Nam khá giống với trình tự đã công bố trên Genbank. Sự sai khác thể hiện giữa loài P. micranthum, P. hangianum, P. malipoense cả ở chiều dài đoạn ITS và cả nucleotide ở một số vị trí. Tuy nhiên sự sai khác này là không lớn lắm, có thể do tính đa dạng di truyền trong cùng 1 loài là khá cao.

2. Phân tích mối quan hệ phát sinh chủng loại

Kết quả phân tích mối quan hệ giữa các loài trong chi Paphiopedilum trên cơ sở phân tích thông tin di truyền đoạn ITS-rDNA của 87 trình tự cho thấy các loài này chia thành 7 nhóm dưới chi tương tự như nghiên cứu của Cox et al. (1997) với 60 loài.
 
Cây điển hình của 100 cây MP


Các trình tự lấy mẫu phân tích ở Việt Nam được in đậm số ở các gốc là giá trị bootstrap

Trong đó các loài của Việt Nam: P. villosum và P. tranlienianum nằm trong dưới chi Paphiopedilum, các loài P. malipoense, P. hangianum và P. micranthum nằm trong dưới chi Parvisepalum - hai dưới chi được ghi nhận phân bố ở các nước như Trung Quốc, Việt Nam, Burma, Thái Lan, Ấn Độ, Lào, Philippin - với giá trị bootstrap khá cao. Loài P. malipoense và P. micranthum phân bố ở Trung Quốc và Việt Nam; loài P. villosum phân bố khá rộng ở Trung Quốc, Việt Nam, Burma, Thái Lan, Ấn Độ nhưng Averyanov & Averyanova (2003) cho rằng P. villosum là loài đặc hữu của Việt Nam nên rất cần có sự bổ sung về phân bố cho loài này. Thêm vào đó, chúng tôi thu nhận được trình tự một số loài được cho là đặc hữu của Việt Nam, P. tranlienianum, P. hangianum (Averyanov & Averyanova, 2003) trên Genbank từ một số nghiên cứu của các nhà khoa học Trung Quốc nhưng rất tiếc các nghiên cứu này đều chưa công bố nên chúng tôi chưa biết rõ được nguồn gốc của các mẫu vật này và giữa chúng cũng có sự sai khác một số nucleotide ở một vài vị trí nên cần có thêm nghiên cứu về vấn đề này.

Kết luận và kiến nghị

Đã giải trình tự DNA vùng ITS được 6 mẫu của 5 loài Lan thuộc chi Paphiopedilum và đối chiếu với dữ liệu trên Genbank bằng phần mềm ClustalX v1.81. Thực hiện thống kê dữ liệu trình tự và phân tích mối quan hệ phát sinh chủng loại của các loài Lan hài bằng phần mềm PAUP v4.0.
Cần có thêm nghiên cứu về đa dạng di truyền trong cùng một loài của Lan hài để có thể xây dựng chiến lược bảo tồn và phát triển bền vững loài cây quý hiếm này

Tài liệu tham khảo

1. Averyanov L., 1988: Preliminary list of the Vietnamese orchids. Leningrad Botanical Institute. USSR Academy of Science 1: 1-247; 2: 1-152. (in Russian).
2. Averyanov L., 1990: Fam. Orchidaceae Juss. Vascular plants synopsis of Vietnamese flora 1. Leningrad. Nauka, Leningrad branch: 5-19.
3. Averyanov L., 1991: Orchid of Vietnam. Thesis For Doctor of Science Degree in Biology. Leningrad. Komarov Botanical Institute. USSR Academy of Science, 61pp. (in Russian).
4. Averyanov L., 1994: Identification guide to Vietnamese orchids (Orchidaceae Juss.). St. Peterbug. World & Family: 432pp (in Russian).
5. Averyanov L., P. Cribb, P. K. Lộc, N. T. Hiệp, 2004: Lan hài Việt Nam với phần giới thiệu về hệ thực vật Việt Nam. NXB. Giao thông vận tải, 308 trang.
6. Cox A.V., A. M. Pridgeon, V. A. Albert, M. W. Chase, 1997: Plant Systematic and Evolution, 208: 197-233.
7. Seidenfaden G., 1992: Opera Botanica, 114: 502 pp.
8. Sun Y., D. Z. Skinner, G. H. Liang, S. H. Hulbert, 1994: Theoretical and Applied Genetics, 89: 26-32.
9. Van den Berg C., D. H. Goldman, J. V. Freudenstein, A. M. Pridgeon, K. M. Cameron, M. W. Chase, 2005: American Journal of Botany, 92: 613-624.
10. Leroy X.J., K. Silladin, M. Branchard, J. L. Jung, 1997: Inter-Simple Sequence Repeat (ISSR) analysis in Cauliflower (Brassica oleracea var. Botrytis L.). ISHS Symposium on Brassicas, Tenth Crucifer genetics workshop, Rennes, 23-27 September 1997.
11. Nghị định của Chính phủ số 32/2006/NĐ - CP ngày 30/3/2006 về quản lý thực vật rừng, động vật rừng nguy cấp, quý, hiếm

Phan Kế Long, Hồ Thị Loan, Nguyễn Giang Sơn, Đặng Tất Thế
Viện ST&TNSV

(Tuyển tập báo cáo Hội nghị Sinh thái và Tài nguyên sinh vật lần thứ 3, 22/10/2009 - Viên ST&TNSV - Viện KH&VN Việt Nam)

anhtai.bvn

Đánh giá:      Google Bookmarks Facebook Twitter   Gửi email     Bản để in     Phản hồi

SÁCH THAM KHẢO

CÁC BÀI MỚI HƠN:
CÁC BÀI ĐĂNG TRƯỚC:
TIN BÀI MỚI NHẤT


ĐƯỢC XEM NHIỀU NHẤT

SÁCH THAM KHẢO

LIÊN KẾT WEBSITE

 
 
 
 
 
 
 

TỪ KHÓA

BVN - BotanyVN - Botany Research and Development Group of Vietnam
(©) Copyright 2007-2024